EST 296620 is a singleton


Sequence

>296620 (1 EST) Length=165 GAAGCTTAACATTTNTTTTATCGATATGATCGTCGNTTCTGGTACTTCTTCTGTTCGAAGTTTTGAGACTTAATTCAGGC GTTTAAATGCCTTTTTTTTTGTTGATTTTTTCGTTTAAAGCATTGCTTAACTGTTATGGACATTTTTAATGGAATAAAGC AAGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 296620: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
296620905424H35925SWAMCA198SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 21:40:17 on Mon 20 Nov 117.