EST 296623 is a singleton


Sequence

>296623 (1 EST) Length=118 ATTACTTACTATAATATATTTACTGAGCGGCAATTATTCACTCATTTTATGCAATGTATTGTGCACTTTACCGCCCGGAA TTTTAACTTATTTCCAGATGACTAGCAAAATGGCATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 296623: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
296623905427H35928SWAMCA202SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 2:44:16 on Fri 19 Jan 118.