EST 2972 is a singleton


Sequence

>2972 (1 EST) Length=414 TGTATATATATTTTTTCATGTGTACATTTTAGAATGGATAAATTAGTACCGATTGTAAACAAATTACAGAATGTTTTATC ATCTTTTATTAGTAGTGAAACCTTGAGCTTACCACATATAGCAGTGGTAGGGGCTCAATCAGTTGGAAAAACCTCATTAC TAGAATCATTAGTAGGTTTAAGTTTTATGCCTAAAGGAGAAGATATAGTAACTCGGACTCCAATAATAATTCAGCTAACG AATTCTAAATCAGATGATTGTTATTGTACCTTAACATATTGTGATTATGATAATAATTGAGTAGAAAANCATATAGATTG NTTTTCCTATTTTGAATGNAATATTAATTGACGGTACCAGAAGGAATTNCTGGGGGGTAATTAAATGTATTAAAGGAACC TCCNATTATAAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 2972: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2972319306T027900132M7gmbPfHB3.1, G. Roman Reddy


Date: 17:26:5 on Wed 22 Nov 117.