EST 2976 is a singleton


Sequence

>2976 (1 EST) Length=355 TTATGTTAATATATAACATGTTATGAGGGTTATTAAGAAAAAGGCTTGGTGGCCTTATTTGAGACGATGGAATTCAAGCG TTACAACTTGCGAAGTGATATATTTGAAGGTTCTTCATATTTTGAAAAGTTTAAAACATACTCAGAAAATTTAATTGAGT GTATAGAAAAATATAAAAAGGATAAAGTGATTTCCTTCAAAAATTATATAACCTATAAAAAAGAAATAAAAGATGTGGTT CATTTTTTATTCAAAGAAGAATCATTAAAACGGTTAAATACANATANTTTATTAAGGATCTTTACATATAGTGGTTTATT ATGTAATAGGGGTATCTTTCCCNCACATTGGCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2976: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2976319310T027940135M3gmbPfHB3.1, G. Roman Reddy


Date: 5:57:30 on Thu 23 Nov 117.