EST 2978 is a singleton


Sequence

>2978 (1 EST) Length=426 ATTTAAAATTTTTTTTTTTTTTTATTAATATTTTTCTATGAATATGGAGATTACAAATTTGAAGAGCTATAAGGAACTTG TCACCTTAAGCGCTGAAGAAAAAACAAAGGATCTAAAGGACTATTTAAATGATAAGAATAGATCTGAATCGTTAATAAAG AAGTTTAAGAATTTTTATATGGATTTATCTCGTCAAAGGTATAGCGAAAAGACTTTAAACAAATTAGTTGAATATGCTGA AGAGGTAGAATTAAAGANGANGGTTGAAAAAACATTTATGGGAGNAAANGTTAATATGCCAGAGNATCGCAGTGTTTTNC ATNCAGCTTTAAAGNATACCCCTTNGGGGNAATTAAATNCNCCTTNAAATCNTTACTTGGTAATACGNATGTGTTTAGNA GCCGGNCCATGGGGGTTTTAAACCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2978: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2978319312T027960136M3gmbPfHB3.1, G. Roman Reddy


Date: 5:4:59 on Sat 18 Nov 117.