EST 2981 is a singleton


Sequence

>2981 (1 EST) Length=354 TGGAATATATTTAAAACCTAAATCATCTAGTCAACATGTTTATGGGATAACAAAAGGTTTTAAAATTTTCCATAAAACAT ATACGGTCATATAAATATATATATCACAATTTTTTTATATTATATTTTTTTTCTACAAAAAAAAAAAAAAAATTGAATTT AAATTATATAAGGTTCTTATCCTAAACAATATGCAAAATAAATGAAATTCACATAAACGATATGTAAATATACATACATA CACATGTATATATATATANNNNTAGTTGCATTTGTGTATTAAATAAATTCCGGGGGTAACCCNAAATGGTTTCCNTTTCT TCCTTATAGNGATCCTTTGCCCCCTTCATTCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2981: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2981319315T027990137M7gmbPfHB3.1, G. Roman Reddy


Date: 22:31:29 on Tue 21 Nov 117.