EST 2982 is a singleton


Sequence

>2982 (1 EST) Length=368 TTTNCTTATAAGTTCTCCTCAAAATAGAAAAAAAAAAAAAAAAAAAAAAAAGNCANCATAGTATAACGANTTTATATCTT TGGGATTATTTAATTTTATAAACCAAAAGAAGAGGAAGAAAGAAAAGAAAAGAAACCAAAANCACATAGATTATTATATA AAACNGGAAAATGGGACCTATGAAATTCGTTTGTTGATTAANTTTTTATTTAAAAGTTTTTTGATGTTTTCCTTATTTCC TAATTTTATTGGAATATTTGTTTATCCATGAGGATTTATTTATTAAACTTNATTGGTGATGNCCTTCCATCATTAAACAT TATGTGTAGGGGGNAAACCTTCAAAACTTGGGCCAAAACCTGGTTAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2982: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2982319316T028000138M3gmbPfHB3.1, G. Roman Reddy


Date: 16:50:34 on Thu 23 Nov 117.