EST 2985 is a singleton


Sequence

>2985 (1 EST) Length=285 GATTGGTTTGTATTATTATTATATGTTGTCTTTTTTTTCGTATATATAAACTTGTCTTCAACAGAAGAAGTAGTATAATT ATNATTTATAGTATTGTCATGTTTGGTTGATTCACTACATAAACTATTATCCTCTTTATTCTCTTTATTTCCGAAATAAT CATAATTTTCAGAATTTCCCTTTTTATGTTTAAATGATCTGCTTATTTAATGTTTCCATCTTTGGATTAACTTCTTTTTT GTTTGTGTGAGACTCCATTTGGATAGTTTTTTTTCTTGTCTTGNT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2985: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2985319319T028030140M3gmbPfHB3.1, G. Roman Reddy


Date: 14:36:1 on Sun 19 Nov 117.