EST 2986 is a singleton


Sequence

>2986 (1 EST) Length=371 TCTCTTTATTATATGTTTTATACCATATAGTTTTATTATGGAACCTATAGAAAATCATCTCAAAAATTACCAATCATATT TCCAATTATATATAATATTACCAATGAGATTTATAGCACATTATTTTAAATTGAATTGTTTCTTTAATAATTCATATAAC GAAATAAACAATAATATAACAGATAATAAGGTACATATATATATATACATATGGTATATACAAAGATTTCTTAAAATAGC TGAACCAATATTTGATTGTNTTCTTTTTACGTTGATTTTTNTCATAATATATGTTTTATATATTNGTGGGATAATGGAAA ANTACAAATAGGTCAAAGGGGTTATAAACACCCAANTTTGGAATTATTCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2986: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2986319320T028040140M7gmbPfHB3.1, G. Roman Reddy


Date: 11:50:12 on Fri 24 Nov 117.