EST 2988 is a singleton


Sequence

>2988 (1 EST) Length=320 TATGGTGTACCTCTATTGAACGTATTTCCTTAATTTTTGCCTCAAATGAATCTTGAAATTTTCCCTTTATAAAAAGAAAA AAGGAATGGGCATTCCAGAATGTATCCAGTTCTGTNATATATTGAGACAAATGTTCCATGGTTGTAATAATTTTATCTAG ATAAGCTAGTCCATTTTTGTTTGGAATCAAAGTAGGTTTATCTTTTACTATAACATCAGATATATAATCAAATACCCATG GTTGTATTTGCTTAACTTGATTAAACCTTGACATATCATTCTTTAAAAGGGTAAACAAAAACCTGTCTTATTATCCATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 2988: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2988319322T028060142M3gmbPfHB3.1, G. Roman Reddy


Date: 12:0:1 on Wed 22 Nov 117.