EST 2989 is a singleton


Sequence

>2989 (1 EST) Length=349 CATATGTAATAAACAAAATAGCAACCTTAAAAAAAGAAGAAACAAATCTTTTGTCAAATAATAATACTTCTTTCGAAAAA GCACCACATGAACACTTATGTCAAGANCAAAATACACCCGGTGATTTGAAAAACACACATAATATATGTAATAATGAATT AGAACGCCAAAGAATGTCCAATGGATGTTGTAATAATAATATAAATGAACATAAAATATATCAAAAAACGGNTGCNCATG ATAATAATTTTAATTTGTGTGTTGACGNTTCTTCAAAGGAAATTGTTCCTGGAAAAAACATGTATCAATTTAAAACTGGT AAACTGGTTATTTTGGGGGGGGAGGTGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2989: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2989319323T028070142M7gmbPfHB3.1, G. Roman Reddy


Date: 4:14:51 on Fri 24 Nov 117.