EST 299963 is a singleton


Sequence

>299963 (1 EST) Length=128 TTATGAACAAGACAAATACATATATGTTGATTTGGATAAGATAAATTTCCCATCAAAAAAAAAAAAAAAACCCCGGGGGG GGGGCCCCCCCCCCACCCCGCCCAATAGGGATTTGTTTAAAACCCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 299963: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
299963914332H39251SWAMCA242SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 12:40:53 on Sun 19 Nov 117.