EST 299972 is a singleton


Sequence

>299972 (1 EST) Length=223 CGTAAGCTTTCATATAGTTGCTGATTGAATAGAGCCAAATTCCTTCATTTATTCCGGCCAAGCAAATACATAATCTGTTT TTTTCTGAGGGGAAAGGAAAAGCCTAGATCAACTATAGGCTATGGGTGGGCCGCACCAAAATGAAGGGGGGTTGTTATAT TATTTATAGTCGNTACGAAACTAATTTTGCTTTGAGTACTTGTCAATACAAAATAAAGGCTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 299972: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
299972914341H39260SWAMCA251SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 0:43:42 on Wed 22 Nov 117.