EST 299988 is a singleton


Sequence

>299988 (1 EST) Length=354 AATATCTACTGCAGCACTATATTTGATGGAAAACATGGCTAAGCATTAAAGATGGCCTGATCGGTAAAAACAATGAACGA ACCTCTGCAGTTANCNCACTAATATTCGTGTGTGCATCAGCGCAATCCTTAATGAAAATCCTAGAATCGGCTGTGGAAAT CTTGTGGTAACGACTCGNTCCTGAATGTGGTGATGGTTTCATTGCATTATTTCCTNTTCCATCACCATCAGTAGTAGATG ACCATTTGTATGCAATCAATGTTGGTGTTTCTGGTGGAAATGCAGTTGCATGTGCTGACTCACTCGCTATAACAGGGCAG NGCAANTTCATTCATATTTATTTATAATATGTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 299988: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
299988914357H39276SWAMCA267SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 8:32:5 on Fri 24 Nov 117.