EST 320160 is a singleton


Sequence

>320160 (1 EST) Length=341 AATGGAGTTTAATTATTACCCTATTATATATGTGATAGGCGCTTAAGGTATCAGATTGCAGGGATTAGTCATAGTTTATG AGTATAGTTATGCGATTGATCTTCAGGTATTTGACTAGGGATATCTATNATATGGATCCAGGAGTATGGATAAAGGATCA TCTGGGNGGAGGATGTCAGTGGTCAGNAACTCTTAATATGATAATCCGCTATATAGGCAAAGGTATCGGTTATATTCATA TAGTGAATNGAGTTTATNCCATCTATNTCGNGAACTAGACANGGATTCTCCTCTGTGATCCTGAGACTAGACCCGGGCGG GGTCTGGACTCCTGNCAGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 320160: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
320160944776R86370SW3ICA319SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 10:1:44 on Wed 22 Nov 117.