EST 320166 is a singleton


Sequence

>320166 (1 EST) Length=308 GTAGATACTTTCCTACTGTGGAAAAAACACATGTATGAGATATTTATAAGATTATTTAGGAAAGCTATATGAATTTGGAA AAGTGAAATTAATGAATGTTTTCCAAAATCAGTTATAGTGGTATTCGTCTAGAATTAATACCCTCACTCTCACCCCTACT ATTCCTAGAATTTATATTTAACTATTCTCCACAATTGAAATAACCTACCTTCCCAAGGGAGGAAAATGAAATGCACATGA AAATTGTATCTTGGTCAAAACCAAAGGTGACCATAATTGGCCTGGCCATTGGTTTGGAAGCTATGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 320166: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
320166944782R86376SW3ICA325SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 0:18:42 on Fri 24 Nov 117.