EST 320182 is a singleton


Sequence

>320182 (1 EST) Length=229 CCCGTGCCGGCACGAGCTGTTTTACTAGGTTTTTTTGATTATTCTTGGTGTGGTTGTTTTTTTTTTGGGGACCCTTTAAA TTGGGGTTCCTAACCTTTAATAAGTGTTTCAATTTAAGGTTTAATGGGGGTCCCTAAGGTTGGGGGTGGCTAAGTTTTTA ATAGGGGCCTAATGGTTTTTTTAAGGGTGGGTTTTTCCACCCCTAAAAGTTGGGGGATTCAATTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 320182: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
320182944798R86392SW3ICA341SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 2:39:17 on Mon 20 Nov 117.