EST 320184 is a singleton


Sequence

>320184 (1 EST) Length=210 GTTCTGTTATTTTATTTTAGTCCTTTTTGGTTTATGGTTTATTTTCCTATTTTGGATTAATAAGGTTTTTTGGATTATCC TTGGTGTGGTTGTTTAGATATTGGGGACCCTTAAAATTGGGGTCCCTAACCTTAAATAAGTGTTTTAATAAAAGGTTTTA TTGGGNACCTAAGGTAGGGGATGACTAAACTTTTAATAGGGGCCTAATCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 320184: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
320184944800R86394SW3ICA343SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 15:1:12 on Thu 23 Nov 117.