EST 320189 is a singleton


Sequence

>320189 (1 EST) Length=379 CAATTTGAGCGTCCAGTAAAACGAGCACGATGGCATCAGGAACATGCGGCACTCGATTACGGTGCACCGTGTTTACAATT TATGGAATTTCATAAACAAGATAAATTTGCCGGTTCAAATATGCAGAAGGAAAGTGAAGACTGCTTATTTCTTAATGTTT TCACACCATTTGATCCAGAAGAAGAATCGAAATTACATCCGATTATTGTATGGATCCATGGTGGATCATTTTTAGCCGGT TCAGGTGACACTGGTATCGATATGGAAGTAATCACGAAACATTTCACATCGAATGGTGTTGCATTAATAACAAGTTAATT ATCGGCTTGGGCTTTTAGGATTTGGGGGGTTTATTAGACAACGACACGTGGGAAGGGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 320189: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
320189944805R86399SW3ICA348SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 23:4:25 on Wed 22 Nov 117.