EST 320236 is a singleton


Sequence

>320236 (1 EST) Length=329 CGGCACGAGTGCTAGAGTTTGGCTAGATGTTCTNATTGGCTGTATTGATCATCTCGATCAGAACAGGCGTCGACCAACCA AAAAATCCAGCATGTGAGCAACTGATTGANTGTTATGCAACATCTCGAGCCAAAACTGACGACTGNCTATCACGTACTGA AAAGCGAGTGTGCCAGAACGANTCTTTAGAGTCAGAACTCAGAGAATCAACCACNGACCGAGTTNCGTTCTATGAAAATT GTGTACGTGAAAACTCGCCCACTAANACANCTATTGANAATGAGAAAAAGAAAGTGAAATGTAATGCANTACTGANGANG AACTTAGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 320236: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
320236945437R86410SWAMCA367SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 4:16:51 on Fri 24 Nov 117.