EST 320242 is a singleton


Sequence

>320242 (1 EST) Length=213 CAGGTNGGAGGTGGTATATTGTGCAGTGGCATACGCTTCACAAAGTATGGTAAAAGAAGTTCAGNANATCAAATCATTTC CTCCACCGATCAGTAGTCCTCCACAGAATTAATGCAAGGGTTGTCTACTGANTGTCCGCCTTCCTAAGAAGTATTACTCT GACATCACTGCAAGCATTAATTTTNCTCTGAATCAATANTACTGTCAATAAAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 320242: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
320242945443R86416SWAMCA377SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 23:43:48 on Sat 18 Nov 117.