EST 333894 is a singleton


Sequence

>333894 (1 EST) Length=267 AAAAATTAGTTTTTATGAAATTATAAATTGTGAATTAATGCGCTTTATTTCATTGAAAGGTACCATTATTGTTANTCCTC TAATGACCAATAATTTAGNATCAATGACCATATCAAATGACCTATGGGTGNTATTCTGTAAAATTATGAGTAAATATNTN CCACTNCCCAATAATGAGGGTATAATATTTATTTCATCGATCATTGNTANTATAATTTTATGCTAGTTAATTACTGATGC ATGTAATATTNGTTATTATTATTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 333894: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
333894965453R93099SWAMCA428SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 14:59:20 on Fri 24 Nov 117.