EST 333898 is a singleton


Sequence

>333898 (1 EST) Length=158 AGCGTCGTCGTTCTCTTTACTACATCGATTTCAGTTCCGAAAACTAAAATTCCTGAAGATAACGTAAATGATCTAGAACT TTTCACTCATCAGTACAGCACCACTAATACCCATCATCACTCAGCCTGATCAACCAACACCACGACAAATTTACAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 333898: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
333898965457R93103EST000037S. mansoni cDNA


Date: 10:11:28 on Wed 22 Nov 117.