EST 333899 is a singleton


Sequence

>333899 (1 EST) Length=95 TCTTACTATGATTATTATAACACTAGTTCAGCAATCCCTTATCTATAAAATGTTATCTTTATTTTGAAATTTTACCATAG TTTGAATGACAGACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 333899: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
333899965458R93104EST000038S. mansoni cDNA


Date: 6:6:7 on Sun 19 Nov 117.