EST 333901 is a singleton


Sequence

>333901 (1 EST) Length=180 GAAGTGAATCACCGATCGTCCTTTTTGTATCAGTCATGCAAATCCAATCACATACAACAAAGAGGCTGAAAAACTACTCG TTTATTAACAGCAGCTTTACCTGGTAATAAACCATGTATTAACAAGTGTTATTATTAACTGTGTGAAATGGTGATAATAA ACTATAAAAATGTCAGCGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 333901: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
333901965460R93106EST000040S. mansoni cDNA


Date: 21:15:25 on Sun 19 Nov 117.