EST 333902 is a singleton


Sequence

>333902 (1 EST) Length=174 GAATAAAAGGATAGCGAAACAGCTGAAAGTATCAGAGAAGCTACTAACTGAACTTCAGCAAGCGTCCTCAAGTTATTCGA AGTTGCCTATAGAAAGATGGCAGGTGAACAGGGAACAAAAACGGACTCTCAAAGTGACGAATCAGCCAAACAAGAAAAGC AGTAATCAACAGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 333902: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
333902965461R93107EST000041S. mansoni cDNA


Date: 5:15:21 on Sat 18 Nov 117.