EST 333903 is a singleton


Sequence

>333903 (1 EST) Length=85 CGGCTGCGAAACGTAAAACGATTCAAGCCGGTGCATGCAACTAAATTGGGGAAGGAATTTAATTTTAAGGCCTTAATTTC CAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 333903: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
333903965462R93108EST000042S. mansoni cDNA


Date: 0:43:11 on Wed 22 Nov 117.