EST 333904 is a singleton


Sequence

>333904 (1 EST) Length=182 TTACAAATATAGTCTCGTAAATCAATTATCTCGTCTTCATATATTCTCTGAAAATATTGAAACTATCCCAAGGACATTAT GCCAATATTTCAGGAGTATACACAGTCATGAAGTCCAAACGCCTTAGGATTACCTCGAAGAACTTATAATTCTAACTTTC GATGGCCGAAGATATATGTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 333904: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
333904965463R93109EST000043S. mansoni cDNA


Date: 9:23:26 on Sun 19 Nov 117.