EST 333906 is a singleton


Sequence

>333906 (1 EST) Length=224 CTTATCCAATGGATGGTTGGTTTTTCACTCGTATGTTTAACTTAGTGGCATGTCCTAATTACACTTATGAGATTATATCA TGGACTGGCTTTCGTATTATGACTCAAACTTTACCAACTCTTATATTTCATATTTGTGGATTCCGTCAAATGAGTGTTTG GGCTATCAGTAAATTAAAAGCGTATCGTCGTGAATTCTCGAATTTCCAAAAAATCGAAAAGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 333906: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
333906965465R93111EST000045S. mansoni cDNA


Date: 5:12:30 on Sat 18 Nov 117.