EST 333907 is a singleton


Sequence

>333907 (1 EST) Length=204 GCAGAACATTAAAGAGAATTTAATTGGCATTACAGCTCACAATATCTATCGCTGGAATCTGACAGGTCAAAACGGGACAC AAACGAAATGGTACGAAAAACAGGCTGACTGGGAAAAAACTGAAGTCCACACTGGTAGTGAGGGCTTGTATTTAAAGCAT TTCTGAGAATGAATTAAATCGATATAGCTAGTAACTTTCTAGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 333907: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
333907965466R93112EST000046S. mansoni cDNA


Date: 6:5:31 on Fri 24 Nov 117.