EST 343519 is a singleton


Sequence

>343519 (1 EST) Length=292 CAGCNCNNTTCNAATGGGATTTTCATTTCTCTGATGCTACTAGAAACAGATTTGTTGCTGCGAAATGAGTGACAACGTCC CAACATGCTTCAACTGTCAGAATAAGCTAGTGTGTGTGGATGAGAGTGTTTTGGAATGCCTCGAGGACGAGCAGAATCCG TTTTTAGNTGATGATGATCCATCGCTTTGCTTTCAAGAAGGTCCCTCAGCAATGACAGGGATTCTGTGGGATTTATTTTG TAATCCAAATTCCAGTTTAAAGGGGACCGATGTGTGAGGTTTGCACAAGAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 343519: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
343519973923R95193SW3ICA360SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 13:23:36 on Thu 23 Nov 117.