EST 343527 is a singleton


Sequence

>343527 (1 EST) Length=340 ACGTATCCTGATAGAGTTGTGGTAGAACNAGGAGCATCGACTAGAGCAGCTCCTGATGATTCACCACCGGCTTATGAGGA TTCATCTAATCCGAACAGTATGCCGCCAACCTATGAATCATTGTATGGTGAATTTCGGCAAGTTGAGGACCCAAGAGGAT TAGCTCAATTTCTAGCAAAAGCTTTGGCAATAATTATTAGTACAATGACCGCTGCGGTGCTTTTGGGCAGTGCTAAATAT CATTCCATTAGGAATGATAGTACTTGGCGGTTGTAATATTCTACAGCTGTCCCGGGGGAACCTTACATACCTATCTTTGG TTCAATGGCAACTGGGTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 343527: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
343527973931R95201SW3ICA380SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 21:2:19 on Sun 19 Nov 117.