EST 343536 is a singleton


Sequence

>343536 (1 EST) Length=310 TTTGCAGGAAGTCGGCACGAGAGCAACCACTGTTACATCACCTATATTTGTACCGATTTCAGCTGTATTACCAGATATTG ATTTTAATGTAAATCATCCATTTATATGCTTTATATATGATCAACAATTAACAATGCCAATCATAGCTGCGAAAGTTATT GAACCAATTATATCATCATAATTGAATTGAATTATATCACTGGTTGCCATAGTAACTATTTGTTTGAATGTAATTCACTT TATANTTTTTCATGAATTAATCAATANNTGAAGATTATTGATTGTTANGATCAACNCGGTCNNCGGGCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 343536: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
343536973940R95210SMNHADA00E021SKSmAW


Date: 11:51:12 on Fri 24 Nov 117.