EST 343553 is a singleton


Sequence

>343553 (1 EST) Length=450 GTAATTTGCNAATTATGGCNAAATCAGATGAGCNAAATGTGATAATGTTGGGAGCAATTAATCAAAATGCAAACGATTTA AGTGGTACAACGTCTAAATAATTCTCCACGGATACGTGGAATACGTTATATTATATTAGTGTCAACGCTGTTATGTCTTG CATCGATTATGTCAAATATTGTCACATTTAATTTTACTGTTCTTTGTATATCACCACAATATGGTAAAGAATTATCACAT GCTAATCAGTCTGCACGAAATGCAAGTCATGAGGGTTCCTCTAAAGATGATAGAACTATTATATTTAGTGCTACTGCAGC GGGGCACTCTTAACTGTAATATTTGGTACACAAGCATTGAGGTATTCGGGACTTCCGAATCATATTTGGGGGTGGGGTGG CATTTTAACAGGTATTACAACAAATGCTTAGGCCCCCCTTGGGAGGNGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 343553: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
343553973957R95227SW3ICA375SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 21:35:51 on Fri 24 Nov 117.