EST 343568 is a singleton


Sequence

>343568 (1 EST) Length=402 GTCGGCGGTTATATGCTTGTCTCCAAGGCTAAGCCNTGCNTGTCTAAGTTCCAATAAACCTATAATGGTGAAACCGCGAA ACGGCTCATTATAACNGCTATAATGTACTTGATGTGGATTATCCAACGTGGATAACTGTGGCAATTCTAGAGCTAATACN TGCACCAAAGCTCCGAATTTTAAACGAGCGCATCTATTAGATTAAAACCAATCGGATTATTAATTTTAATCCGTTAATTG GTGACTCTGAATAGCTATGGCTGATCGCATGGTCTTGTACCGGCGACGTTTCTATCAAGTGTCTTGTGATGCCCTTAGAT GTCCAGGGCTGCACGCGCGCTACACTGGAGGAATCAGGGGGCTGTAACCATTAACCGAANGGTTTTGGTAACCCCCGGGA AA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 343568: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
343568973972R95242SW3ICA406SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 14:18:57 on Mon 20 Nov 117.