EST 344388 is a singleton


Sequence

>344388 (1 EST) Length=88 CACGTTTACAGTTCTAGTAGTATATCTGTAGAACAAATATTACAACTTCATTTGAAAAGCGATTTGTTAATCAATGATCA TACAGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344388: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344388972789L46921SCMRAP008G2/KS adult worm mini-library


Date: 19:31:5 on Mon 20 Nov 117.