EST 344393 is a singleton


Sequence

>344393 (1 EST) Length=111 GATTAAGTGGTGGAGGTCCAGGGTGACTGACTGAACAGTTTCGAGTGTATGATACATCCGNAGNGGACCAAGTGTTTGAT GTCATCAAATTAGAGCCGTACATATTTTGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344393: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344393972794L46926SCMRAP013G2/KS adult worm mini-library


Date: 8:53:26 on Fri 24 Nov 117.