EST 344395 is a singleton


Sequence

>344395 (1 EST) Length=66 GATCGAGGTGNAATCGAAAATTCAGCAGTTACCTGGATCTGGTTTGTATTCATTATTTGTACCGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344395: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344395972796L46928SCMRAP015G2/KS adult worm mini-library


Date: 15:9:47 on Fri 24 Nov 117.