EST 344396 is a singleton


Sequence

>344396 (1 EST) Length=100 TCCCCACCCCATTATTTGCAATTATTATAACCATATCAATTTTCGGACTTATTCTCTTGGTTTTAACTATTGTATTTGTT ATTCGTAACAAAGGAGCGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344396: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344396972797L46929SCMRAP016G2/KS adult worm mini-library


Date: 23:17:27 on Mon 20 Nov 117.