EST 344416 is a singleton


Sequence

>344416 (1 EST) Length=427 AGGTAAGGCTTTAGGAGATTAGTTCAGTATGGCTGACGGAAACCTGTGCTGTAACTCATTATTTGCATTGAGCTATTAGA AGTAGTCTAAAANATCGGTTTATTTCAGTAGTTTCTCCTCAGGTGCTTATAACTATTTATGTAGTGAAATGTAACTCTGA GGTAAAATATAATGTGACATAATTNACAGTGGTGACGATAAGAATTAAAATGACAAGGATTATGAAAAATGATATCGACA ATATTATTCTAATTCTNTCTGTCAATAATGTCAATCGTTTCACATTACGTATTACCTTAATGTTACATTTCAATGCATAT ATGGTTGTAAGCAGTTGATTAAAAANCCACGNAATATAATGNTTCAAATTATTCTGATTCCATCGNGGTTTCAGCTTTAT TCAAATTCATAAAGGGACCAATCGCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344416: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344416972817L46949SCMRAP036C2/C2 adult worm mini-library


Date: 9:37:4 on Thu 23 Nov 117.