EST 344425 is a singleton


Sequence

>344425 (1 EST) Length=123 TGATTTTAGGCTTTCAGTGACTGCCTAACTTATGTAGGTTCGTGATCCCAGTAACTCAAGTATAGAATATTATTAAACTG GCGACCATTTTTGTATTTTTTTAAAATAAATTCTTTNTCATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344425: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344425972826L46958SCMRAP045C2/tcz2 adult worm mini-library


Date: 15:54:43 on Tue 21 Nov 117.