EST 344438 is a singleton


Sequence

>344438 (1 EST) Length=208 GTTGTTAGATTTGGATATCGATAAAACTGAGGAATATCTGGCAAAATTAGTGGTAAATAAAACAATTTACGCTAAAATTG ATCGACTTGAAGGAGTGGTACANNTTATAGCCAAAAAGATGCCGACAGAAGTTTTAAAAGATTGGGCTNAACAAAACTAG AAANNAATGGCCCCGTCCAACCGTCACTCCCAGGAGGNACGCGACCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 344438: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344438972839L46971SCMRAP058C2/tcz2 adult worm mini-library


Date: 13:51:18 on Mon 20 Nov 117.