EST 344440 is a singleton


Sequence

>344440 (1 EST) Length=173 GTCAAGCACCCAAATCGGACGCAGAACTACTAAAAGAAGTTTGCATTATTCTGAAGATATACAATCTTTTTCCCAAGATA AACTAAGAGCCGCTAAACGCCAGCGTCTGTCTAGTTCAAAAGCTCGGCAAATAGGCGCCTACCATAGTAGTTCGTCACAT TCAANGTCAACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344440: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344440972841L46973SCMRAP060C2/tcz2 adult worm mini-library


Date: 9:34:33 on Sun 19 Nov 117.