EST 344442 is a singleton


Sequence

>344442 (1 EST) Length=185 GTGTTACGCTTTGTTTTTAATATTGGTCGAATTCTGTCGATCAAATGCTTCAATTTTGACTGGCTACGTGAATGANCTAG TTGGCTTTATCGATCACTCAGTCAGGGTATAATAACGTTTATATCATTCTTGTANATAAGCCTGATTGAAATATAATATT AANNCCATAGCTTACTGANCAACCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344442: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344442972843L46975SCMRAP062C2/tcz2 adult worm mini-library


Date: 17:13:12 on Fri 24 Nov 117.