EST 344443 is a singleton


Sequence

>344443 (1 EST) Length=216 GTTGAGANCGAGCCACACAGACTTGACTCCCGATTGGCTTCAAGGTCTANCTGTACCTACCCAAAANACCCACATTTCNG ATTGTTTGTGACTTCAATNNGTTACTTGTNCCACCTTGTTGGCACCAGGTCAAGGTTTTAGGACCTTATTTCCCAAGAGG GAACCAAACCCAGGTTTTTTCCCAACCACCTTGTTCAAATTGGTNGGGGCCTTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344443: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344443972844L46976SCMRAP063C2/tcz2 adult worm mini-library


Date: 16:14:38 on Sat 18 Nov 117.