EST 344447 is a singleton


Sequence

>344447 (1 EST) Length=161 TAGTAGTAGTAGTAGTGGTGATACATATGTGACAAAAGTATACGTTAAAAATTTTTTTTTCAGAGATAATAGTAAATCAT GGATAACTATTGANCGANAGCGAAGATACTNCTGAATACTAATAAGTAGTAATCANTTGTATGTAAATNNGCAGGTATTA A


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344447: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344447972848L46980SCMRAP067C2/tcz2 adult worm mini-library


Date: 9:46:54 on Fri 24 Nov 117.