EST 344449 is a singleton


Sequence

>344449 (1 EST) Length=153 GTTCAAAAAGTCGTTAGATGTTTGTGTAAACCATGGTCGTAAGGGTAGGCAACCTAGATAGGGTCCGCTAAATCATCGNG AATAGATGGCTGGAGTTGTGTGAATATGGCTTAGGAATCAATCACAAATGGTGCAAGTGCATTCACTTTCTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344449: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344449972850L46982SCMRAP069C2/tcz2 adult worm mini-library


Date: 2:23:1 on Wed 22 Nov 117.