EST 344450 is a singleton


Sequence

>344450 (1 EST) Length=109 ATGTTCTTGTTGACATATTTTGCACCATAAACATACATGTAAACTGAACTACTTGTAAAAAATGTAATTTTTCCATTGCC TCCTAATTTGTTTTTTCTCCCTTTTGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344450: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344450972851L46983SCMRAP070C2/tcz2 adult worm mini-library


Date: 11:59:20 on Wed 22 Nov 117.