EST 344453 is a singleton


Sequence

>344453 (1 EST) Length=256 GTTTAGAAGACTATTTTTATAGCGATCCAACTACTTCCAGATAGGTGTCTACCTTGTGATTGTGATCGAGTTGGTTCAAC AAGTGATTTATGCGATCCATTAACAGGAGTGACGGTTGATCAGTGGGAGTTCTTCAGAGGCGTATGAACAACCGTCACTC CGGAGTGACGTTGATCAGTTCTTTTCCACTTAAACCTAAGATGTATGGGGGTTAGCTTGTAGCACTAACTTCAGTGTAAA TAGAATTATTGTATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 344453: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344453972854L46986SCMRAP073C2/tcz2 adult worm mini-library


Date: 19:11:32 on Wed 22 Nov 117.