EST 344455 is a singleton


Sequence

>344455 (1 EST) Length=243 TTATTGGCACCAATGTGGTTTCATTTTCCTAAAGATGTGAATACGTTTGATTTGGATGATCAATATATGGTTGGAGAAGC TGTGCTTGTGCGTTCTTTCTTTGGTTGTAAACGTTCTACTTAATATTNGTCGTGCTTTAGCATCAATATATGTGTCCAGT CAGTTACAGTTAGTCGTCGCACAGCAAGGCAGTCATGCAGTTTNCNGTTTACTATGCATCTGTACTTCATTTATTCTGTT GGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 344455: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344455972856L46988SCMRAP075C2/tcz2 adult worm mini-library


Date: 18:6:44 on Fri 17 Nov 117.